circad | circRNAs associated with diseases

Circ-ZNF609/hsa_circ_0000615
Gene	ZNF609	Organism	Human
Genome Locus	chr15:64791491-64792365:+	Build	hg19
Disease	Hirschsprung disease	ICD-10	Hirschsprung disease (Q43.1)
DBLink	Link to database	PMID	27903978
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	HSCR colon tissues and normal adjacent tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGCGCTCAATCCTTTGGGA Reverse GACCTGCCACATTGGTCAGTA	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Peng, L, Chen, G, Zhu, Z, Shen, Z, Du, C, Zang, R, Su, Y, Xie, H, Li, H, Xu, X, Xia, Y, Tang, W (2017). Circular RNA ZNF609 functions as a competitive endogenous RNA to regulate AKT3 expression by sponging miR-150-5p in Hirschsprung's disease. Oncotarget, 8, 1:808-818.